Stem-loop sequence mml-mir-342

Accession MI0007704
Description Macaca mulatta miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop
gaaac     u        g      --ua      auuga      ugg  a 
     ugggc caagguga gggugc    ucugug     gggaca   uu a
     ||||| |||||||| ||||||    ||||||     ||||||   ||  
     auccg guuccacu cccacg    agacac     cucugu   ag u
-auuc     -        g      cuaa      ----a      -ua  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 163376912-163377010 [+]
sense
ENSMMUT00000021642 ; EVL-201; intron 2
Database links

Mature sequence mml-miR-342-5p

Accession MIMAT0006282
Sequence

19 - 

aggggugcuaucugugauuga

 - 39

Get sequence
Evidence by similarity; MI0000805
Predicted targets

Mature sequence mml-miR-342-3p

Accession MIMAT0006283
Sequence

61 - 

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Evidence by similarity; MI0000805
Predicted targets

References

1