Stem-loop sequence mml-mir-342

Accession MI0007704
Description Macaca mulatta miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop
   gaaac     u        g      --ua      auuga      ugg  a 
5'      ugggc caagguga gggugc    ucugug     gggaca   uu a
        ||||| |||||||| ||||||    ||||||     ||||||   ||  
3'      auccg guuccacu cccacg    agacac     cucugu   ag u
   -auuc     -        g      cuaa      ----a      -ua  g 
Get sequence
Deep sequencing
36676 reads, 514 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 163986775-163986873 [+]
intergenic
Database links

Mature sequence mml-miR-342-5p

Accession MIMAT0006282
Sequence

19 - 

aggggugcuaucugugauuga

 - 39

Get sequence
Deep sequencing 22 reads, 3 experiments
Evidence by similarity; MI0000805
Predicted targets

Mature sequence mml-miR-342-3p

Accession MIMAT0006283
Sequence

61 - 

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Deep sequencing 275 reads, 6 experiments
Evidence by similarity; MI0000805
Predicted targets

References

1