Stem-loop sequence mml-mir-340

Accession MI0007703
Description Macaca mulatta miR-340 stem-loop
Gene family MIPF0000191; mir-340
Stem-loop
   --uu     u      au       -caa      u    g     ug 
5'     guacc ggugug  uauaaag    ugagac gauu ucaua  u
       ||||| ||||||  |||||||    |||||| |||| |||||  u
3'     uaugg ccauac  auauuuc    acucug cuag ggugu  g
   auuc     u      cg       auug      c    -     uu 
Get sequence
Deep sequencing
38332 reads, 687 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 178974856-178974950 [-]
intergenic
Database links

Mature sequence mml-miR-340-5p

Accession MIMAT0006281
Sequence

16 - 

uuauaaagcaaugagacugauu

 - 37

Get sequence
Deep sequencing 24 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-340-3p

Accession MIMAT0026854
Sequence

58 - 

uccgucucaguuacuuuauagcc

 - 80

Get sequence
Deep sequencing 6 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).