Stem-loop sequence mml-mir-340

Accession MI0007703
Description Macaca mulatta miR-340 stem-loop
Gene family MIPF0000191; mir-340
Stem-loop
--uu     u      au       -caa      u    g     ug 
    guacc ggugug  uauaaag    ugagac gauu ucaua  u
    ||||| ||||||  |||||||    |||||| |||| |||||  u
    uaugg ccauac  auauuuc    acucug cuag ggugu  g
auuc     u      cg       auug      c    -     uu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 176698926-176699020 [-]
sense
ENSMMUT00000040531 ; RNF130-201; intron 1
ENSMMUT00000018733 ; RNF130-202; intron 4
Database links

Mature sequence mml-miR-340-5p

Accession MIMAT0006281
Sequence

16 - 

uuauaaagcaaugagacugauu

 - 37

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-340-3p

Accession MIMAT0026854
Sequence

58 - 

uccgucucaguuacuuuauagcc

 - 80

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).