Stem-loop sequence mml-mir-338

AccessionMI0007701 (change log)
DescriptionMacaca mulatta miR-338 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      c      u   -         -   g  ga 
5' ucu caacaa auc cuggugcug agu au  c
   ||| |||||| ||| ||||||||| ||| ||  u
3' aga guuguu uag gacuacgac uca ug  c
      a      u   u         c   g  ga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 74986911-74986977 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-338
mml-mir-1250chr16: 74994245-74994354 [-]
mml-mir-338chr16: 74986911-74986977 [-]
mml-mir-657chr16: 74986304-74986382 [-]
Database links

Mature sequence mml-miR-338-5p

Accession MIMAT0006277
Sequence

6 - 

aacaauauccuggugcugagug

 - 27

Get sequence
Evidence by similarity; MI0000814
Database links
Predicted targets

Mature sequence mml-miR-338-3p

Accession MIMAT0006278
Sequence

42 - 

uccagcaucagugauuuuguug

 - 63

Get sequence
Evidence by similarity; MI0000814
Database links
Predicted targets

References

1