Stem-loop sequence mml-mir-338

AccessionMI0007701
DescriptionMacaca mulatta miR-338 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c      u   -         -   g  ga 
ucu caacaa auc cuggugcug agu au  c
||| |||||| ||| ||||||||| ||| ||  u
aga guuguu uag gacuacgac uca ug  c
   a      u   u         c   g  ga 
Get sequence
Deep sequencing
41629 reads, 530 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr16: 78715586-78715652 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-338
mml-mir-1250chr16: 78723001-78723110 [-]
mml-mir-338chr16: 78715586-78715652 [-]
Database links

Mature sequence mml-miR-338-5p

Accession MIMAT0006277
Sequence

6 - 

aacaauauccuggugcugagug

 - 27

Get sequence
Deep sequencing19 reads, 3 experiments
Evidence by similarity; MI0000814
Predicted targets

Mature sequence mml-miR-338-3p

Accession MIMAT0006278
Sequence

42 - 

uccagcaucagugauuuuguug

 - 63

Get sequence
Deep sequencing191 reads, 6 experiments
Evidence by similarity; MI0000814
Predicted targets

References

1