Stem-loop sequence mml-mir-337

AccessionMI0007700
DescriptionMacaca mulatta miR-337 stem-loop
Gene family MIPF0000195; mir-337
Stem-loop
guagucagua uu         -   c   u     c        -   ca 
          g  ggggggugg gaa ggc ucaua aggaguug aug  c
          |  ||||||||| ||| ||| ||||| |||||||| |||   
          c  uccccuacu cuu ccg aguau uccucgac uau  a
--------aa -u         u   u   u     a        c   ug 
Get sequence
Deep sequencing
334 reads, 6.91 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164771909-164772001 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-337
mml-mir-493chr7: 164766619-164766707 [+]
mml-mir-337chr7: 164771909-164772001 [+]
mml-mir-665chr7: 164772450-164772521 [+]
mml-mir-431chr7: 164778839-164778952 [+]
mml-mir-433chr7: 164779718-164779810 [+]
mml-mir-127chr7: 164780811-164780907 [+]
Database links

Mature sequence mml-miR-337-5p

Accession MIMAT0006275
Sequence

23 - 

gaacggcuucauacaggaguu

 - 43

Get sequence
Evidence by similarity; MI0000806
Predicted targets

Mature sequence mml-miR-337-3p

Accession MIMAT0006276
Sequence

61 - 

cuccuauaugaugccuuucuuc

 - 82

Get sequence
Deep sequencing258 reads, 8 experiments
Evidence by similarity; MI0000806
Predicted targets

References

1