Stem-loop sequence mml-mir-337

AccessionMI0007700 (change log)
DescriptionMacaca mulatta miR-337 stem-loop
Gene family MIPF0000195; mir-337
Stem-loop
   guagucagua uu         -   c   u     c        -   ca 
5'           g  ggggggugg gaa ggc ucaua aggaguug aug  c
             |  ||||||||| ||| ||| ||||| |||||||| |||   
3'           c  uccccuacu cuu ccg aguau uccucgac uau  a
   --------aa -u         u   u   u     a        c   ug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163207975-163208067 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-337
mml-mir-493chr7: 163202837-163202925 [+]
mml-mir-337chr7: 163207975-163208067 [+]
mml-mir-665chr7: 163208516-163208587 [+]
mml-mir-431chr7: 163215205-163215318 [+]
mml-mir-433chr7: 163216084-163216176 [+]
mml-mir-127chr7: 163217177-163217273 [+]
Database links

Mature sequence mml-miR-337-5p

Accession MIMAT0006275
Sequence

23 - 

gaacggcuucauacaggaguu

 - 43

Get sequence
Evidence by similarity; MI0000806
Predicted targets

Mature sequence mml-miR-337-3p

Accession MIMAT0006276
Sequence

61 - 

cuccuauaugaugccuuucuuc

 - 82

Get sequence
Evidence by similarity; MI0000806
Database links
Predicted targets

References

1