Stem-loop sequence mml-mir-337

Accession MI0007700
Description Macaca mulatta miR-337 stem-loop
Gene family MIPF0000195; mir-337
Stem-loop
guagucagua uu         -   c   u     c        -   ca 
          g  ggggggugg gaa ggc ucaua aggaguug aug  c
          |  ||||||||| ||| ||| ||||| |||||||| |||   
          c  uccccuacu cuu ccg aguau uccucgac uau  a
--------aa -u         u   u   u     a        c   ug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164158315-164158407 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-337
mml-mir-493 7: 164153015-164153103 [+]
mml-mir-337 7: 164158315-164158407 [+]
mml-mir-665 7: 164158856-164158927 [+]
mml-mir-431 7: 164164951-164165064 [+]
mml-mir-433 7: 164165830-164165922 [+]
mml-mir-127 7: 164166923-164167019 [+]
Database links

Mature sequence mml-miR-337-5p

Accession MIMAT0006275
Sequence

23 - 

gaacggcuucauacaggaguu

 - 43

Get sequence
Evidence by similarity; MI0000806
Predicted targets

Mature sequence mml-miR-337-3p

Accession MIMAT0006276
Sequence

61 - 

cuccuauaugaugccuuucuuc

 - 82

Get sequence
Evidence by similarity; MI0000806
Predicted targets

References

1