Stem-loop sequence mml-mir-335

Accession MI0007699
Description Macaca mulatta miR-335 stem-loop
Gene family MIPF0000196; mir-335
Stem-loop
--------------   c        a         c        u  gu 
              gag ggggguca gagcaauaa gaaaaaug uu  c
              ||| |||||||| ||||||||| |||||||| ||   
              cuc ccuccagu cucguuauu cuuuuugc aa  a
acuuauaucguuua   u        c         a        c  au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 167886990-167887077 [+]
sense
ENSMMUT00000041796 ; MMU.716-201; intron 2
ENSMMUT00000041795 ; MMU.716-202; intron 2
ENSMMUT00000041794 ; MMU.716-203; intron 2
ENSMMUT00000013260 ; MMU.716-204; intron 2
Database links

Mature sequence mml-miR-335-5p

Accession MIMAT0006274
Sequence

10 - 

ucaagagcaauaacgaaaaaugu

 - 32

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-335-3p

Accession MIMAT0026853
Sequence

46 - 

uuuuucauuauugcuccugacc

 - 67

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).