Stem-loop sequence mml-mir-335

AccessionMI0007699
DescriptionMacaca mulatta miR-335 stem-loop
Gene family MIPF0000196; mir-335
Stem-loop
--------------   c        a         c        u  gu 
              gag ggggguca gagcaauaa gaaaaaug uu  c
              ||| |||||||| ||||||||| |||||||| ||   
              cuc ccuccagu cucguuauu cuuuuugc aa  a
acuuauaucguuua   u        c         a        c  au 
Get sequence
Deep sequencing
21365 reads, 326 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr3: 169440244-169440331 [+]
intergenic
Database links

Mature sequence mml-miR-335-5p

Accession MIMAT0006274
Sequence

10 - 

ucaagagcaauaacgaaaaaugu

 - 32

Get sequence
Deep sequencing164 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-335-3p

Accession MIMAT0026853
Sequence

46 - 

uuuuucauuauugcuccugacc

 - 67

Get sequence
Deep sequencing14 reads, 4 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).