Stem-loop sequence mml-mir-331

AccessionMI0007698 (change log)
DescriptionMacaca mulatta miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   gaguuugguuuu         u        u    u       au ccaga 
5'             guuuggguu guucuagg augg cccaggg  c     u
               ||||||||| |||||||| |||| |||||||  |     c
3'             caaauccaa caagaucc uauc ggguccc  g     a
   ----------cu         c        -    c       cg accaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 95122240-95122333 [+]
intergenic
Database links

Mature sequence mml-miR-331-5p

Accession MIMAT0006272
Sequence

26 - 

cuagguauggucccagggaucc

 - 47

Get sequence
Evidence by similarity; MI0000812
Database links
Predicted targets

Mature sequence mml-miR-331-3p

Accession MIMAT0006273
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Evidence by similarity; MI0000812
Database links
Predicted targets

References

1