Stem-loop sequence mml-mir-331

AccessionMI0007698
DescriptionMacaca mulatta miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
gaguuugguuuu         u        u    u       au ccaga 
            guuuggguu guucuagg augg cccaggg  c     u
            ||||||||| |||||||| |||| |||||||  |     c
            caaauccaa caagaucc uauc ggguccc  g     a
----------cu         c        -    c       cg accaa 
Get sequence
Deep sequencing
1941 reads, 38.3 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr11: 97055366-97055459 [+]
intergenic
Database links

Mature sequence mml-miR-331-5p

Accession MIMAT0006272
Sequence

26 - 

cuagguauggucccagggaucc

 - 47

Get sequence
Deep sequencing67 reads, 6 experiments
Evidence by similarity; MI0000812
Predicted targets

Mature sequence mml-miR-331-3p

Accession MIMAT0006273
Sequence

61 - 

gccccugggccuauccuagaa

 - 81

Get sequence
Deep sequencing44 reads, 7 experiments
Evidence by similarity; MI0000812
Predicted targets

References

1