Stem-loop sequence mml-mir-330

AccessionMI0007697 (change log)
DescriptionMacaca mulatta miR-330 stem-loop
Gene family MIPF0000200; mir-330
Stem-loop
   cuuu   -  u a           --    -    u   ag    ugcaa 
5'     ggc ga c cugccucucug  ggcc ugug cuu  gcuc     g
       ||| || | |||||||||||  |||| |||| |||  ||||     a
3'     ccg cu g gacggagagac  ccgg acac gaa  cgag     u
   ---c   u  c c           gu    c    -   -a    ccaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 40984405-40984498 [-]
antisense
ENSMMUT00000038469 ; MARK4-204; intron 3
ENSMMUT00000026254 ; MARK4-201; intron 5
ENSMMUT00000026252 ; MARK4-203; intron 6
ENSMMUT00000026253 ; MARK4-202; intron 6
Database links

Mature sequence mml-miR-330-5p

Accession MIMAT0006270
Sequence

18 - 

ucucugggccugugucuuaggc

 - 39

Get sequence
Evidence by similarity; MI0000803
Database links
Predicted targets

Mature sequence mml-miR-330-3p

Accession MIMAT0006271
Sequence

57 - 

gcaaagcacacggccugcagaga

 - 79

Get sequence
Evidence by similarity; MI0000803
Database links
Predicted targets

References

1