Stem-loop sequence mml-mir-330

Accession MI0007697
Description Macaca mulatta miR-330 stem-loop
Gene family MIPF0000200; mir-330
Stem-loop
cuuu   -  u a           --    -    u   ag    ugcaa 
    ggc ga c cugccucucug  ggcc ugug cuu  gcuc     g
    ||| || | |||||||||||  |||| |||| |||  ||||     a
    ccg cu g gacggagagac  ccgg acac gaa  cgag     u
---c   u  c c           gu    c    -   -a    ccaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 52090459-52090552 [-]
sense
ENSMMUT00000026743 ; EML2-201; intron 4
Database links

Mature sequence mml-miR-330-5p

Accession MIMAT0006270
Sequence

18 - 

ucucugggccugugucuuaggc

 - 39

Get sequence
Evidence by similarity; MI0000803
Predicted targets

Mature sequence mml-miR-330-3p

Accession MIMAT0006271
Sequence

57 - 

gcaaagcacacggccugcagaga

 - 79

Get sequence
Evidence by similarity; MI0000803
Predicted targets

References

1