Stem-loop sequence mml-mir-329-2

Accession MI0007696
Description Macaca mulatta miR-329-2 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
     cu           uu ug   cuc      u  ac 
gguac  gaagggagguu  c  ggu   uguuuc uu  u
|||||  |||||||||||  |  |||   |||||| ||   
cuaug  cuuuucuccaa  g  cca   acaaag ag  g
     ac           uu gu   --c      u  ga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164312902-164312981 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-329-2
mml-mir-379 7: 164307862-164307928 [+]
mml-mir-411 7: 164309121-164309202 [+]
mml-mir-299 7: 164309587-164309649 [+]
mml-mir-380 7: 164310810-164310870 [+]
mml-mir-323a 7: 164311526-164311611 [+]
mml-mir-758 7: 164311819-164311906 [+]
mml-mir-329-1 7: 164312583-164312666 [+]
mml-mir-329-2 7: 164312902-164312981 [+]
mml-mir-494 7: 164314563-164314643 [+]
mml-mir-543 7: 164316909-164316988 [+]
mml-mir-495 7: 164318758-164318839 [+]
Database links

Mature sequence mml-miR-329-2-5p

Accession MIMAT0031107
Sequence

13 - 

gagguuuucugggucucuguuu

 - 34

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-329-3p

Accession MIMAT0006269
Sequence

50 - 

aacacaccugguuaaccucuuu

 - 71

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).