Stem-loop sequence mml-mir-329-2

Accession MI0007696
Description Macaca mulatta miR-329-2 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
        cu           uu ug   cuc      u  ac 
5' gguac  gaagggagguu  c  ggu   uguuuc uu  u
   |||||  |||||||||||  |  |||   |||||| ||   
3' cuaug  cuuuucuccaa  g  cca   acaaag ag  g
        ac           uu gu   --c      u  ga 
Get sequence
Deep sequencing
147 reads, 2.47 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164926555-164926634 [+]
intergenic
chr7: 164926872-164926951 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-329-2
mml-mir-379 chr7: 164921832-164921898 [+]
mml-mir-411 chr7: 164923091-164923172 [+]
mml-mir-299 chr7: 164923557-164923619 [+]
mml-mir-380 chr7: 164924780-164924840 [+]
mml-mir-323a chr7: 164925496-164925581 [+]
mml-mir-758 chr7: 164925789-164925876 [+]
mml-mir-329-2 chr7: 164926555-164926634 [+]
mml-mir-329-2 chr7: 164926872-164926951 [+]
mml-mir-494 chr7: 164928535-164928615 [+]
mml-mir-543 chr7: 164930881-164930960 [+]
mml-mir-495 chr7: 164932634-164932715 [+]
Database links

Mature sequence mml-miR-329-2-5p

Accession MIMAT0031107
Sequence

13 - 

gagguuuucugggucucuguuu

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-329-3p

Accession MIMAT0006269
Sequence

50 - 

aacacaccugguuaaccucuuu

 - 71

Get sequence
Deep sequencing 3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).