Stem-loop sequence mml-mir-329-1

AccessionMI0007695 (change log)
DescriptionMacaca mulatta miR-329-1 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   g      cu           uu ug   uuc      u  aa 
5'  ugguac  gaagggagguu  c  ggu   uguuuc uu  u
    ||||||  |||||||||||  |  |||   |||||| ||   
3'  acuaug  cuuuucuccaa  g  cca   acaaag ag  g
   a      ac           uu gu   --c      u  ga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163362091-163362174 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-329-1
mml-mir-379chr7: 163357370-163357436 [+]
mml-mir-411chr7: 163358629-163358710 [+]
mml-mir-299chr7: 163359095-163359157 [+]
mml-mir-380chr7: 163360318-163360378 [+]
mml-mir-323achr7: 163361034-163361119 [+]
mml-mir-758chr7: 163361327-163361414 [+]
mml-mir-329-1chr7: 163362091-163362174 [+]
mml-mir-329-2chr7: 163362410-163362489 [+]
mml-mir-494chr7: 163364071-163364151 [+]
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
Database links

Mature sequence mml-miR-329-1-5p

Accession MIMAT0026852
Sequence

15 - 

gagguuuucuggguuucuguuuc

 - 37

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-329-3p

Accession MIMAT0006269
Sequence

52 - 

aacacaccugguuaaccucuuu

 - 73

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).