|
miRBase |
|
Stem-loop sequence mml-mir-329-1 |
|||||
| Accession | MI0007695 | ||||
| Description | Macaca mulatta miR-329-1 stem-loop | ||||
| Gene family | MIPF0000110; mir-329 | ||||
| Stem-loop |
g cu uu ug uuc u aa ugguac gaagggagguu c ggu uguuuc uu u |||||| ||||||||||| | ||| |||||| || acuaug cuuuucuccaa g cca acaaag ag g a ac uu gu --c u ga |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-329 |
|
| Accession | MIMAT0006269 |
| Sequence |
52 - aacacaccugguuaaccucuuu - 73 |
| Evidence | by similarity; MI0001726 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|