Stem-loop sequence mml-mir-329-1

AccessionMI0007695
DescriptionMacaca mulatta miR-329-1 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
g      cu           uu ug   uuc      u  aa 
 ugguac  gaagggagguu  c  ggu   uguuuc uu  u
 ||||||  |||||||||||  |  |||   |||||| ||   
 acuaug  cuuuucuccaa  g  cca   acaaag ag  g
a      ac           uu gu   --c      u  ga 
Get sequence
Deep sequencing
167 reads, 3.65 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-329-1-5p

Accession MIMAT0026852
Sequence

15 - 

gagguuuucuggguuucuguuuc

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-329-3p

Accession MIMAT0006269
Sequence

52 - 

aacacaccugguuaaccucuuu

 - 73

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).