Stem-loop sequence mml-mir-325

Accession MI0007694
Description Macaca mulatta miR-325 stem-loop
Gene family MIPF0000147; mir-325
Stem-loop
   ----------au             cc   u    g c      gu uu guu 
5'             gcagugcuugguu  uag aggu u caguaa  g  u   a
               |||||||||||||  ||| |||| | ||||||  |  |    
3'             ugucacgaacuaa  auc ucca g guuauu  u  a   c
   ggucucggaucg             cu   c    g a      ug uu aua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 76275378-76275475 [-]
sense
ENSMMUT00000031764 ; ATRX-202; intron 21
ENSMMUT00000047933 ; ATRX-201; intron 22
ENSMMUT00000031763 ; ATRX-203; intron 22
Database links

Mature sequence mml-miR-325

Accession MIMAT0006268
Sequence

16 - 

ccuaguagguguccaguaagugu

 - 38

Get sequence
Evidence by similarity; MI0000824
Predicted targets

References

1