Stem-loop sequence mml-mir-323a

AccessionMI0007692
DescriptionMacaca mulatta miR-323a stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
---uu      u g        g u     gcgc  u    uua 
     gguacu g agagaggu g ccgug    gu cgcu   u
     |||||| | |||||||| | |||||    || ||||    
     cuauga c uuucucca c ggcac    ca gcgg   u
cuaau      - g        g u     auua  c    uau 
Get sequence
Deep sequencing
2364 reads, 31.1 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164925496-164925581 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-323a
mml-mir-379chr7: 164921832-164921898 [+]
mml-mir-411chr7: 164923091-164923172 [+]
mml-mir-299chr7: 164923557-164923619 [+]
mml-mir-380chr7: 164924780-164924840 [+]
mml-mir-323achr7: 164925496-164925581 [+]
mml-mir-758chr7: 164925789-164925876 [+]
mml-mir-329-2chr7: 164926555-164926634 [+]
mml-mir-329-2chr7: 164926872-164926951 [+]
mml-mir-494chr7: 164928535-164928615 [+]
mml-mir-543chr7: 164930881-164930960 [+]
mml-mir-495chr7: 164932634-164932715 [+]
Database links

Mature sequence mml-miR-323a-5p

Accession MIMAT0006264
Sequence

16 - 

aggugguccguggcgcguucgc

 - 37

Get sequence
Evidence by similarity; MI0000807
Predicted targets

Mature sequence mml-miR-323a-3p

Accession MIMAT0006265
Sequence

51 - 

cacauuacacggucgaccucu

 - 71

Get sequence
Deep sequencing48 reads, 4 experiments
Evidence by similarity; MI0000807
Predicted targets

References

1