Stem-loop sequence mml-mir-320a

AccessionMI0007691
Previous IDsmml-mir-320
DescriptionMacaca mulatta miR-320 stem-loop
Gene family MIPF0000163; mir-320
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g     c   -ccuc         uu       c      g 
 cuucg ucc     cgccuucuc  cccgguu uucccg a
 ||||| |||     |||||||||  ||||||| ||||||  
 ggagu agg     gcgggagag  gggucga aagggc g
-     -   aaaaa         uu       a      u 
Get sequence
Deep sequencing
51941 reads, 891 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 22229815-22229895 [-]
antisense
ENSMMUT00000020262 ; PIWIL2-201; intron 9
Database links

Mature sequence mml-miR-320a

Accession MIMAT0006263
Previous IDsmml-miR-320
Sequence

48 - 

aaaagcuggguugagagggcga

 - 69

Get sequence
Deep sequencing113 reads, 7 experiments
Evidence by similarity; MI0000542
Predicted targets

References

1