Stem-loop sequence mml-mir-320a

Accession MI0007691
Previous IDs mml-mir-320
Description Macaca mulatta miR-320 stem-loop
Gene family MIPF0000163; mir-320
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g     c   -ccuc         uu       c      g 
 cuucg ucc     cgccuucuc  cccgguu uucccg a
 ||||| |||     |||||||||  ||||||| ||||||  
 ggagu agg     gcgggagag  gggucga aagggc g
-     -   aaaaa         uu       a      u 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 22168828-22168908 [-]
intergenic
Database links

Mature sequence mml-miR-320a

Accession MIMAT0006263
Previous IDs mml-miR-320
Sequence

48 - 

aaaagcuggguugagagggcga

 - 69

Get sequence
Evidence by similarity; MI0000542
Predicted targets

References

1