Stem-loop sequence mml-mir-302d

AccessionMI0007690 (change log)
DescriptionMacaca mulatta miR-302d stem-loop
Gene family MIPF0000071; mir-302
Literature search

3 open access papers mention mml-mir-302d
(12 sentences)

Stem-loop
     u u    u                -cug  gu 
5' cc c acuu aacauggaggcacuug    ug  a
   || | |||| ||||||||||||||||    ||   
3' gg g ugag uuguaccuucgugaau    ac  u
     u -    u                aaaa  ag 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 111570414-111570481 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-302d
mml-mir-302bchr5: 111570892-111570967 [-]
mml-mir-302cchr5: 111570757-111570824 [-]
mml-mir-302achr5: 111570580-111570648 [-]
mml-mir-302dchr5: 111570414-111570481 [-]
mml-mir-367chr5: 111570284-111570351 [-]
Database links

Mature sequence mml-miR-302d

Accession MIMAT0006262
Sequence

44 - 

uaagugcuuccauguuugagugu

 - 66

Get sequence
Deep sequencing11 reads, 5 experiments
Evidence by similarity; MI0000774
Predicted targets

References

1