Stem-loop sequence mml-mir-302c

AccessionMI0007689 (change log)
DescriptionMacaca mulatta miR-302c stem-loop
Gene family MIPF0000071; mir-302
Literature search

3 open access papers mention mml-mir-302c
(12 sentences)

Stem-loop
       ug  uu             c    -g  u 
5' ccuu  cu  aacauggggguac ugcu  ug g
   ||||  ||  ||||||||||||| ||||  || a
3' ggag  ga  uuguaccuucgug auga  ac a
       gu  cu             a    aa  a 
Get sequence
Deep sequencing
61 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 111570757-111570824 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-302c
mml-mir-302bchr5: 111570892-111570967 [-]
mml-mir-302cchr5: 111570757-111570824 [-]
mml-mir-302achr5: 111570580-111570648 [-]
mml-mir-302dchr5: 111570414-111570481 [-]
mml-mir-367chr5: 111570284-111570351 [-]
Database links

Mature sequence mml-miR-302c

Accession MIMAT0006261
Sequence

43 - 

uaagugcuuccauguuucagugg

 - 65

Get sequence
Deep sequencing60 reads, 9 experiments
Evidence by similarity; MI0000773
Predicted targets

References

1