Stem-loop sequence mml-mir-302b

AccessionMI0007688 (change log)
DescriptionMacaca mulatta miR-302b stem-loop
Gene family MIPF0000071; mir-302
Literature search

3 open access papers mention mml-mir-302b
(13 sentences)

Stem-loop
        cuuca   uu          ug   u  gugacu 
5' gcucc     acu  aacauggaag  cuu cu      u
   |||||     |||  ||||||||||  ||| ||       
3' ugagg     uga  uuguaccuuc  gaa ga      u
        ----a   uu          gu   u  auaaaa 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 111570892-111570967 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-302b
mml-mir-302bchr5: 111570892-111570967 [-]
mml-mir-302cchr5: 111570757-111570824 [-]
mml-mir-302achr5: 111570580-111570648 [-]
mml-mir-302dchr5: 111570414-111570481 [-]
mml-mir-367chr5: 111570284-111570351 [-]
Database links

Mature sequence mml-miR-302b

Accession MIMAT0006260
Sequence

50 - 

uaagugcuuccauguuuuaguag

 - 72

Get sequence
Deep sequencing65 reads, 9 experiments
Evidence by similarity; MI0000772
Predicted targets

References

1