Stem-loop sequence mml-mir-302a

AccessionMI0007687 (change log)
DescriptionMacaca mulatta miR-302a stem-loop
Gene family MIPF0000071; mir-302
Literature search

3 open access papers mention mml-mir-302a
(12 sentences)

Stem-loop
      c    u         u           gaa 
5' cca cacu aaacgugga guacuugcuuu   a
   ||| |||| ||||||||| |||||||||||   c
3' ggu gugg uuuguaccu cgugaaugaag   u
      a    u         u           aaa 
Get sequence
Deep sequencing
129 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 111570580-111570648 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-302a
mml-mir-302bchr5: 111570892-111570967 [-]
mml-mir-302cchr5: 111570757-111570824 [-]
mml-mir-302achr5: 111570580-111570648 [-]
mml-mir-302dchr5: 111570414-111570481 [-]
mml-mir-367chr5: 111570284-111570351 [-]
Database links

Mature sequence mml-miR-302a-5p

Accession MIMAT0026851
Sequence

9 - 

uaaacguggauguacuugcuuu

 - 30

Get sequence
Deep sequencing72 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-302a-3p

Accession MIMAT0006259
Sequence

44 - 

uaagugcuuccauguuuugguga

 - 66

Get sequence
Deep sequencing13 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).