![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-302a |
||||||||||||
Accession | MI0007687 (change log) | |||||||||||
Description | Macaca mulatta miR-302a stem-loop | |||||||||||
Gene family | MIPF0000071; mir-302 | |||||||||||
Literature search |
![]()
3 open access papers mention mml-mir-302a | |||||||||||
Stem-loop |
c u u gaa 5' cca cacu aaacgugga guacuugcuuu a ||| |||| ||||||||| ||||||||||| c 3' ggu gugg uuuguaccu cgugaaugaag u a u u aaa |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
Mature sequence mml-miR-302a-5p |
|
Accession | MIMAT0026851 |
Sequence |
9 - uaaacguggauguacuugcuuu - 30 |
Deep sequencing | 72 reads, 7 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mml-miR-302a-3p |
|
Accession | MIMAT0006259 |
Sequence |
44 - uaagugcuuccauguuuugguga - 66 |
Deep sequencing | 13 reads, 5 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|