Stem-loop sequence mml-mir-301a

AccessionMI0007685 (change log)
DescriptionMacaca mulatta miR-301a stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention mml-mir-301a
(1 sentences)

Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   g     aa  c     a    uuau          cgauc       
Get sequence
Deep sequencing
6471 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 30490677-30490762 [+]
sense
ENSMMUT00000024179 ; BCAS3-202; intron 22
ENSMMUT00000024178 ; BCAS3-203; intron 23
Database links

Mature sequence mml-miR-301a-5p

Accession MIMAT0026850
Sequence

16 - 

ucugacuuuauugcacuacu

 - 35

Get sequence
Deep sequencing78 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-301a-3p

Accession MIMAT0006257
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Deep sequencing6393 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).