Stem-loop sequence mml-mir-301a

Accession MI0007685
Description Macaca mulatta miR-301a stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma. It has been shown that miR-130a is expressed in the hematopoietic stem/progenitor cell compartment but not in mature blood cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   g     aa  c     a    uuau          cgauc       
Get sequence
Deep sequencing
4976 reads, 82.2 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr16: 45399085-45399170 [-]
sense
ENSMMUT00000024179 ; BCAS3-202; intron 22
ENSMMUT00000024178 ; BCAS3-203; intron 23
Database links

Mature sequence mml-miR-301a-5p

Accession MIMAT0026850
Sequence

16 - 

ucugacuuuauugcacuacu

 - 35

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-301a-3p

Accession MIMAT0006257
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Deep sequencing 3524 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).