Stem-loop sequence mml-mir-301a

Accession

MI0007685

Description

Macaca mulatta miR-301a stem-loop

Gene family

MIPF0000034; mir-130

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Stem-loop

a     aa  a     c    ---u          ----a       
 cugcu  cg augcu ugac    uuauugcacu     cuguac 
 |||||  || ||||| ||||    ||||||||||     ||||| u
 gacga  gu uacga acug    gauaacguga     gacauu 
g     aa  c     a    uuau          cgauc       

Genome context

• Coordinates (MMUL1.0): 16: 43395599-43395684 [-]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 100315230;MIR301A

Mature sequence mml-miR-301a

• Accession: MIMAT0006257
• Sequence: 51 - cagugcaauaguauugucaaagc - 73
• Evidence: by similarity; MI0000745
• Predicted targets:
  • TARGETSCAN-VERT:mml-miR-301a

References

1. PMID:18186931 "Identification of novel homologous microRNA genes in the rhesus macaque genome" Yue J, Sheng Y, Orwig KE BMC Genomics. 9:8(2008).