Stem-loop sequence mml-mir-299

DescriptionMacaca mulatta miR-299 stem-loop
Gene family MIPF0000186; mir-299
        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  c
3' uucuu gccaaauggcaggguguaugua  a
        c                      ua 
Get sequence
Deep sequencing
27172 reads, 451 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164923557-164923619 [+]
Clustered miRNAs
< 10kb from mml-mir-299
mml-mir-379chr7: 164921832-164921898 [+]
mml-mir-411chr7: 164923091-164923172 [+]
mml-mir-299chr7: 164923557-164923619 [+]
mml-mir-380chr7: 164924780-164924840 [+]
mml-mir-323achr7: 164925496-164925581 [+]
mml-mir-758chr7: 164925789-164925876 [+]
mml-mir-329-2chr7: 164926555-164926634 [+]
mml-mir-329-2chr7: 164926872-164926951 [+]
mml-mir-494chr7: 164928535-164928615 [+]
mml-mir-543chr7: 164930881-164930960 [+]
mml-mir-495chr7: 164932634-164932715 [+]
Database links

Mature sequence mml-miR-299-5p

Accession MIMAT0006255

7 - 


 - 28

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence by similarity; MI0000744
Predicted targets

Mature sequence mml-miR-299-3p

Accession MIMAT0006256

39 - 


 - 60

Get sequence
Deep sequencing83 reads, 4 experiments
Evidence by similarity; MI0000744
Predicted targets
