Stem-loop sequence mml-mir-299

Accession MI0007684
Description Macaca mulatta miR-299 stem-loop
Gene family MIPF0000186; mir-299
Stem-loop
     a                      uu 
aagaa ugguuuaccgucccacauacau  u
||||| ||||||||||||||||||||||  c
uucuu gccaaauggcaggguguaugua  a
     c                      ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164309587-164309649 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-299
mml-mir-379 7: 164307862-164307928 [+]
mml-mir-411 7: 164309121-164309202 [+]
mml-mir-299 7: 164309587-164309649 [+]
mml-mir-380 7: 164310810-164310870 [+]
mml-mir-323a 7: 164311526-164311611 [+]
mml-mir-758 7: 164311819-164311906 [+]
mml-mir-329-1 7: 164312583-164312666 [+]
mml-mir-329-2 7: 164312902-164312981 [+]
mml-mir-494 7: 164314563-164314643 [+]
mml-mir-543 7: 164316909-164316988 [+]
mml-mir-495 7: 164318758-164318839 [+]
Database links

Mature sequence mml-miR-299-5p

Accession MIMAT0006255
Sequence

7 - 

ugguuuaccgucccacauacau

 - 28

Get sequence
Evidence by similarity; MI0000744
Predicted targets

Mature sequence mml-miR-299-3p

Accession MIMAT0006256
Sequence

39 - 

uaugugggacgguaaaccgcuu

 - 60

Get sequence
Evidence by similarity; MI0000744
Predicted targets

References

1