Stem-loop sequence mml-mir-298

Accession MI0007683
Description Macaca mulatta miR-298 stem-loop
Gene family MIPF0000206; mir-298
Stem-loop
---   gg    c      --   c  g      uc -    g uu 
   uca  ucuu agcaga  agc gg ugguuc  c cagu g  u
   |||  |||| ||||||  ||| || ||||||  | |||| |  u
   agu  agga ucguuu  ucg cc aucaag  g guca u  c
ucg   -a    c      ug   u  g      ga u    g uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 5712275-5712362 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-298
mml-mir-298 10: 5712275-5712362 [+]
mml-mir-296 10: 5712878-5712957 [+]
Database links

Mature sequence mml-miR-298

Accession MIMAT0006254
Sequence

11 - 

agcagaagccgggugguucuccca

 - 34

Get sequence
Evidence by similarity; MI0005523
Predicted targets

References

1