|
miRBase |
|
Stem-loop sequence mml-mir-298 |
||||||
| Accession | MI0007683 | |||||
| Description | Macaca mulatta miR-298 stem-loop | |||||
| Gene family | MIPF0000206; mir-298 | |||||
| Stem-loop |
--- gg c -- c g uc - g uu uca ucuu agcaga agc gg ugguuc c cagu g u ||| |||| |||||| ||| || |||||| | |||| | u agu agga ucguuu ucg cc aucaag g guca u c ucg -a c ug u g ga u g uc |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence mml-miR-298 |
|
| Accession | MIMAT0006254 |
| Sequence |
11 - agcagaagccgggugguucuccca - 34 |
| Evidence | by similarity; MI0005523 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|