Stem-loop sequence mml-mir-298

AccessionMI0007683 (change log)
DescriptionMacaca mulatta miR-298 stem-loop
Gene family MIPF0000206; mir-298
Stem-loop
   ---   gg    c      --   c  g      uc -    g uu 
5'    uca  ucuu agcaga  agc gg ugguuc  c cagu g  u
      |||  |||| ||||||  ||| || ||||||  | |||| |  u
3'    agu  agga ucguuu  ucg cc aucaag  g guca u  c
   ucg   -a    c      ug   u  g      ga u    g uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 5590153-5590240 [+]
antisense
ENSMMUT00000014346 ; GNAS1-204; intron 5
ENSMMUT00000014369 ; GNAS1-202; intron 6
ENSMMUT00000014366 ; GNAS1-201; intron 6
ENSMMUT00000014368 ; GNAS1-205; intron 7
ENSMMUT00000045171 ; GNAS1-207; intron 7
ENSMMUT00000014360 ; GNAS1-203; intron 8
Clustered miRNAs
< 10kb from mml-mir-298
mml-mir-298chr10: 5590153-5590240 [+]
mml-mir-296chr10: 5590756-5590835 [+]
Database links

Mature sequence mml-miR-298

Accession MIMAT0006254
Sequence

11 - 

agcagaagccgggugguucuccca

 - 34

Get sequence
Evidence by similarity; MI0005523
Predicted targets

References

1