Stem-loop sequence mml-mir-297

Accession MI0007682
Description Macaca mulatta miR-297 stem-loop
Gene family MIPF0000204; mir-297
Stem-loop
u u       u       -              u 
 g auguaug gugcaug ugcauauaugugug g
 | ||||||| ||||||| ||||||||||||||  
 c uauauac cauguau auguauauauauau u
a -       u       u              a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 103768703-103768770 [-]
intergenic
Database links

Mature sequence mml-miR-297

Accession MIMAT0006253
Sequence

4 - 

auguaugugugcaugugcau

 - 23

Get sequence
Evidence by similarity; MI0005775
Predicted targets

References

1