Stem-loop sequence mml-mir-297

Accession MI0007682
Description Macaca mulatta miR-297 stem-loop
Gene family MIPF0000204; mir-297
Stem-loop
   u u       u       -              u 
5'  g auguaug gugcaug ugcauauaugugug g
    | ||||||| ||||||| ||||||||||||||  
3'  c uauauac cauguau auguauauauauau u
   a -       u       u              a 
Get sequence
Deep sequencing
4 reads, 0.395 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr5: 105186843-105186910 [+]
intergenic
Database links

Mature sequence mml-miR-297

Accession MIMAT0006253
Sequence

4 - 

auguaugugugcaugugcau

 - 23

Get sequence
Evidence by similarity; MI0005775
Predicted targets

References

1