Stem-loop sequence mml-mir-296

Accession MI0007681
Description Macaca mulatta miR-296 stem-loop
Gene family MIPF0000159; mir-296
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-296. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-296 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-296 has been named an "angiomiR" due to being characterised as a microRNA which regulates angiogenesis, the process of growth and creation of new blood vessels. miR-296 is thought to have a specific role in cancer in promoting tumour angiogenesis. It achieves this by targeting HGS mRNA, reducing its expression in endothelial cells which then results in greater number of VEGF receptors. miR-296 has predicted target sites in the transcription factor NANOG and may also contribute to carcinogenesis by dysregulating p53.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  ga      ca       c  c         g   ugc 
ag  cccuuc  gagggcc cc cucaauccu uug   c
||  ||||||  ||||||| || ||||||||| |||   u
uc  gggaag  cucucgg gg ggguuggga gac   a
  uc      uc       a  u         -   uua 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 5712878-5712957 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-296
mml-mir-298 10: 5712275-5712362 [+]
mml-mir-296 10: 5712878-5712957 [+]
Database links

Mature sequence mml-miR-296-5p

Accession MIMAT0006251
Sequence

14 - 

agggcccccccucaauccugu

 - 34

Get sequence
Evidence by similarity; MI0000747
Predicted targets

Mature sequence mml-miR-296-3p

Accession MIMAT0006252
Sequence

48 - 

gaggguuggguggaggcucucc

 - 69

Get sequence
Evidence by similarity; MI0000747
Predicted targets

References

1