Stem-loop sequence mml-mir-222

Accession MI0007680
Description Macaca mulatta miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
gcu          auaggua  c   au              -     auc   ucuu 
   gcuggaaggu       cc uca  ggcucaguagccag uguag   cug    u
   ||||||||||       || |||  |||||||||||||| |||||   |||    c
   cgaucuucua       gg agu  cugggucaucgguc acauc   gac    g
--u          ------c  u   cu              u     gac   uaau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 43560139-43560248 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-222
mml-mir-222 X: 43560139-43560248 [-]
mml-mir-221 X: 43559275-43559384 [-]
Database links

Mature sequence mml-miR-222-5p

Accession MIMAT0026849
Sequence

33 - 

caguagccaguguagaucc

 - 51

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-222-3p

Accession MIMAT0006250
Sequence

69 - 

agcuacaucuggcuacugggu

 - 89

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).