Stem-loop sequence mml-mir-219-2

Accession MI0007676
Description Macaca mulatta miR-219-2 stem-loop
Gene family MIPF0000044; mir-219
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-219_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, the microRNA miR-219 was predicted in vertebrates by conservation between human, mouse and pufferfish and cloned in pufferfish. It was later predicted and confirmed experimentally in Drosophila. Homologs of miR-219 have since been predicted or experimentally confirmed in a wide range of species, including the platyhelminth Schmidtea mediterranea, several arthropod species and a wide range of vertebrates (MIPF0000044). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. miR-219 has also been linked with NMDA receptor signalling in humans, and it has been suggested that deregulation of this miRNA can lead to the expression of mental disorders such as schizophrenia.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a   a       c     u   u     aa           uac a  c 
5'  cuc ggggcuu gccac gau gucca  cgcaauucuug   g gu u
    ||| ||||||| ||||| ||| |||||  |||||||||||   | || g
3'  ggg ccucgag cggug cua caggu  guguuaagagc   c cg c
   -   -       u     u   -     cg           caa -  g 
Get sequence
Deep sequencing
170253 reads, 2.14e+03 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-219-5p

Accession MIMAT0006245
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence by similarity; MI0000740
Predicted targets

Mature sequence mml-miR-219-3p

Accession MIMAT0006246
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Deep sequencing 300 reads, 4 experiments
Evidence by similarity; MI0000740
Predicted targets

References

1