Stem-loop sequence mml-mir-218-1

AccessionMI0007675 (change log)
DescriptionMacaca mulatta miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   -----aau  a   a   u      u         cu        gg    gag 
5'         gu gcg gau uucugu gugcuugau  aaccaugu  uugc   g
           || ||| ||| |||||| |||||||||  ||||||||  ||||   u
3'         cg cgc cug aaggua cacgaacug  uugguaca  aaug   a
   acaucuuu  a   a   c      c         cc        -a    agu 
Get sequence
Deep sequencing
28477 reads, 111 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 19895038-19895142 [+]
antisense
ENSMMUT00000042386 ; KCNIP4-201; intron 1
ENSMMUT00000042385 ; KCNIP4-202; intron 1
Database links

Mature sequence mml-miR-218-5p

Accession MIMAT0002574
Sequence

20 - 

uugugcuugaucuaaccaugu

 - 40

Get sequence
Deep sequencing56537 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-218-1-3p

Accession MIMAT0031080
Sequence

63 - 

augguuccgucaagcaccaug

 - 83

Get sequence
Deep sequencing199 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).