Stem-loop sequence mml-mir-218-1

Accession MI0007675
Description Macaca mulatta miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-218_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-218 microRNA precursor is a small non-coding RNA that regulates gene expression by antisense binding. miR-218 appears to be a vertebrate specific microRNA and has now been predicted and experimentally confirmed in a wide range of vertebrate species. The extents of the hairpin precursors are not known. In this case the mature sequence in excised from the 5'arm of the hairpin. miR-218, along with miR-585, has been found to be silenced by DNA methylation in oral squamous cell carcinoma. It is also downregulated in Nasopharyngeal carcinoma, with artificially-induced expression serving to slow tumour growth. miR-218 has also been found to have tumour suppressing qualities in bladder cancer cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-----aau  a   a   u      u         cu        gg    gag 
        gu gcg gau uucugu gugcuugau  aaccaugu  uugc   g
        || ||| ||| |||||| |||||||||  ||||||||  ||||   u
        cg cgc cug aaggua cacgaacug  uugguaca  aaug   a
acaucuuu  a   a   c      c         cc        -a    agu 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 15312111-15312215 [+]
sense
ENSMMUT00000003717 ; B6EZF0_MACMU; intron 16
ENSMMUT00000003718 ; B6EZF0_MACMU; intron 16
ENSMMUT00000003717 ; B6EZF0_MACMU; intron 16
ENSMMUT00000003718 ; B6EZF0_MACMU; intron 16
ENSMMUT00000003717 ; B6EZF0_MACMU; intron 16
ENSMMUT00000003718 ; B6EZF0_MACMU; intron 16
Database links

Mature sequence mml-miR-218

Accession MIMAT0002574
Sequence

20 - 

uugugcuugaucuaaccaugu

 - 40

Get sequence
Evidence by similarity; MI0000294
Predicted targets

References

1