Stem-loop sequence mml-mir-216a

AccessionMI0007672 (change log)
DescriptionMacaca mulatta miR-216a stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   ---------------gaug   g  ag     u         cu   a        ---a   u 
5'                    gcu ug  uuggc uaaucucag  ggc acugugag    ugu c
                      ||| ||  ||||| |||||||||  ||| ||||||||    |||  
3'                    cga ac  aaucg auuaggguc  cug ugacacuc    aca a
   agcgcucccguuccuuuaa   g  -a     c         -u   g        ccua   u 
Get sequence
Deep sequencing
392 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr13: 56964578-56964687 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-216a
mml-mir-216achr13: 56964578-56964687 [-]
mml-mir-217chr13: 56958681-56958790 [-]
Database links

Mature sequence mml-miR-216a-5p

Accession MIMAT0006242
Sequence

19 - 

uaaucucagcuggcaacuguga

 - 40

Get sequence
Deep sequencing382 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-216a-3p

Accession MIMAT0026848
Sequence

60 - 

acaguggucucugggauuacg

 - 80

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).