Stem-loop sequence mml-mir-212

AccessionMI0007671 (change log)
DescriptionMacaca mulatta miR-212 stem-loop
Gene family MIPF0000065; mir-132
Stem-loop
   cggggcaccccgcccgga   c   c   -ca        cu      c      ccc     
5'                   cag gcg cgg   ccuuggcu  agacug uuacug   gggc 
                     ||| ||| |||   ||||||||  |||||| ||||||   ||| c
3'                   guc cgc gcc   gggacuga  ucugac aaugac   cccg 
   ----------ccgccccg   -   a   acc        cc      -      --u     
Get sequence
Deep sequencing
1728 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 1943555-1943664 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-212
mml-mir-212chr16: 1943555-1943664 [-]
mml-mir-132chr16: 1943195-1943295 [-]
Database links

Mature sequence mml-miR-212-5p

Accession MIMAT0026847
Sequence

31 - 

accuuggcucuagacugcuuacu

 - 53

Get sequence
Deep sequencing376 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-212-3p

Accession MIMAT0006241
Sequence

71 - 

uaacagucuccagucagggcc

 - 91

Get sequence
Deep sequencing1352 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).