Stem-loop sequence mml-mir-210

AccessionMI0007670 (change log)
DescriptionMacaca mulatta miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

1 open access papers mention mml-mir-210
(2 sentences)

Stem-loop
   accc  ca  - cc           gg     c   cc   -      c  c -     
5'     gg  gu c  uccaggcgcag  cagcc cug  cac cgcaca ug g cugc 
       ||  || |  |||||||||||  ||||| |||  ||| |||||| || | ||| c
3'     cc  cg g  ggguccguguc  gucgg gac  gug gcgugu ac c gacc 
   ---c  ag  c ac           ua     c   -a   u      c  c a     
Get sequence
Deep sequencing
2752 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 409390-409499 [-]
intergenic
Database links

Mature sequence mml-miR-210-5p

Accession MIMAT0026846
Sequence

28 - 

agccccugcccaccgcacacug

 - 49

Get sequence
Deep sequencing43 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-210-3p

Accession MIMAT0006240
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Deep sequencing2706 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).