Stem-loop sequence mml-mir-210

Accession MI0007670
Description Macaca mulatta miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
accc  ca  - cc           gg     c   cc   -      c  c -     
    gg  gu c  uccaggcgcag  cagcc cug  cac cgcaca ug g cugc 
    ||  || |  |||||||||||  ||||| |||  ||| |||||| || | ||| c
    cc  cg g  ggguccguguc  gucgg gac  gug gcgugu ac c gacc 
---c  ag  c ac           ua     c   -a   u      c  c a     
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
14: 372934-373043 [-]
intergenic
Database links

Mature sequence mml-miR-210

Accession MIMAT0006240
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Evidence by similarity; MI0000286
Predicted targets

References

1