Stem-loop sequence mml-mir-210

Accession MI0007670
Description Macaca mulatta miR-210 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   accc  ca  - cc           gg     c   cc   -      c  c -     
5'     gg  gu c  uccaggcgcag  cagcc cug  cac cgcaca ug g cugc 
       ||  || |  |||||||||||  ||||| |||  ||| |||||| || | ||| c
3'     cc  cg g  ggguccguguc  gucgg gac  gug gcgugu ac c gacc 
   ---c  ag  c ac           ua     c   -a   u      c  c a     
Get sequence
Deep sequencing
243 reads, 5.91 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-210-5p

Accession MIMAT0026846
Sequence

28 - 

agccccugcccaccgcacacug

 - 49

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-210-3p

Accession MIMAT0006240
Sequence

66 - 

cugugcgugugacagcggcuga

 - 87

Get sequence
Deep sequencing 26 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).