Stem-loop sequence mml-mir-208b

AccessionMI0007669 (change log)
DescriptionMacaca mulatta miR-208b stem-loop
Gene family MIPF0000178; mir-208
Literature search

1 open access papers mention mml-mir-208b
(1 sentences)

Stem-loop
   --c        g          c   aa        cu 
5'    cucucagg aagcuuuuug ucg  uuauguuu  g
      |||||||| |||||||||| |||  ||||||||  a
3'    gggagucu uuuggaaaac agc  aauauaag  u
   gac        g          a   ag        cc 
Get sequence
Deep sequencing
682 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 84770499-84770575 [-]
sense
ENSMMUT00000000598 ; SLC7A7-201; intron 4
Database links

Mature sequence mml-miR-208b-5p

Accession MIMAT0026845
Sequence

11 - 

aagcuuuuugcucgaauuaugu

 - 32

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-208b-3p

Accession MIMAT0006239
Sequence

46 - 

auaagacgaacaaaagguuugu

 - 67

Get sequence
Deep sequencing677 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).