Stem-loop sequence mml-mir-208a

AccessionMI0007668 (change log)
DescriptionMacaca mulatta miR-208a stem-loop
Gene family MIPF0000178; mir-208
Literature search

1 open access papers mention mml-mir-208a
(1 sentences)

Stem-loop
   u   ag          g  c  gg      c  a 
5'  gac  gcgagcuuuu gc cg  uuauac ug u
    |||  |||||||||| || ||  |||||| || g
3'  cug  uguucgaaaa cg gc  aauaug ac c
   a   gu          a  a  ag      c  u 
Get sequence
Deep sequencing
1291 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 84741046-84741116 [-]
antisense
ENSMMUT00000000595 ; OXA1L-201; intron 3
ENSMMUT00000000597 ; OXA1L-202; intron 3
Database links

Mature sequence mml-miR-208a-5p

Accession MIMAT0026844
Sequence

9 - 

gagcuuuuggcccggguuauac

 - 30

Get sequence
Deep sequencing190 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-208a-3p

Accession MIMAT0006238
Sequence

44 - 

auaagacgagcaaaaagcuugu

 - 65

Get sequence
Deep sequencing1101 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).