Stem-loop sequence mml-mir-206

AccessionMI0007667 (change log)
DescriptionMacaca mulatta miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

2 open access papers mention mml-mir-206
(8 sentences)

Stem-loop
   u    c                        cc     u g uu 
5'  gcuu ccgaggccacaugcuucuuuauau  ccaua g a  a
    |||| ||||||||||||||||||||||||  ||||| | |   
3'  ugaa ggcuuuggugugugaaggaaugua  gguau c u  c
   g    c                        -a     - g uu 
Get sequence
Deep sequencing
68077 reads, 256 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 53106130-53106215 [+]
antisense
ENSMMUT00000040477 ; GSTA3-201; intron 3
ENSMMUT00000029510 ; GSTA3-203; intron 3
Clustered miRNAs
< 10kb from mml-mir-206
mml-mir-206chr4: 53106130-53106215 [+]
mml-mir-133bchr4: 53110676-53110794 [+]
Database links

Mature sequence mml-miR-206

Accession MIMAT0006237
Sequence

53 - 

uggaauguaaggaagugugugg

 - 74

Get sequence
Deep sequencing68074 reads, 9 experiments
Evidence by similarity; MI0000490
Database links
Predicted targets

References

1