Stem-loop sequence mml-mir-205

AccessionMI0007666 (change log)
DescriptionMacaca mulatta miR-205 stem-loop
Gene family MIPF0000058; mir-205
Literature search

2 open access papers mention mml-mir-205
(6 sentences)

Stem-loop
   aaagaucc    gcaa       gcuu      uc           c        ucuca 
5'         ucag    uccaugu    cucuug  cuucauuccac ggagucug     u
           ||||    |||||||    ||||||  ||||||||||| ||||||||     a
3'         aguc    agguacg    gaggac  gaagugaggug cuuuagac     c
   ------gc    ---g       ----      uu           a        caacc 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 157131475-157131584 [-]
intergenic
Database links

Mature sequence mml-miR-205

Accession MIMAT0006236
Sequence

34 - 

uccuucauuccaccggagucug

 - 55

Get sequence
Deep sequencing16 reads, 6 experiments
Evidence by similarity; MI0000285
Predicted targets

References

1