Stem-loop sequence mml-mir-204

AccessionMI0007665 (change log)
DescriptionMacaca mulatta miR-204 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   ggcuacagucuuucu   -  -    ucg     u          a     u    gagaau 
5'                uca ug ugac   uggac ucccuuuguc uccua gccu      a
                  ||| || ||||   ||||| |||||||||| ||||| ||||      u
3'                ggu ac acug   acuug agggaaacgg agggu cgga      a
   --------------c   c  u    uua     c          a     -    ggaagu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 86992597-86992706 [-]
sense
Database links

Mature sequence mml-miR-204-5p

Accession MIMAT0006235
Sequence

33 - 

uucccuuugucauccuaugccu

 - 54

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-204-3p

Accession MIMAT0026843
Sequence

71 - 

ggcugggaaggcaaagggacgu

 - 92

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).