Stem-loop sequence mml-mir-204

AccessionMI0007665
DescriptionMacaca mulatta miR-204 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
ggcuacagucuuucu   -  -    ucg     u          a     u    gagaau 
               uca ug ugac   uggac ucccuuuguc uccua gccu      a
               ||| || ||||   ||||| |||||||||| ||||| ||||      u
               ggu ac acug   acuug agggaaacgg agggu cgga      a
--------------c   c  u    uua     c          a     -    ggaagu 
Get sequence
Deep sequencing
2727 reads, 71.1 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr15: 80469726-80469835 [-]
sense
Database links

Mature sequence mml-miR-204-5p

Accession MIMAT0006235
Sequence

33 - 

uucccuuugucauccuaugccu

 - 54

Get sequence
Deep sequencing23 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-204-3p

Accession MIMAT0026843
Sequence

71 - 

ggcugggaaggcaaagggacgu

 - 92

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).