Stem-loop sequence mml-mir-204

Accession MI0007665
Description Macaca mulatta miR-204 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
ggcuacagucuuucu   -  -    ucg     u          a     u    gagaau 
               uca ug ugac   uggac ucccuuuguc uccua gccu      a
               ||| || ||||   ||||| |||||||||| ||||| ||||      u
               ggu ac acug   acuug agggaaacgg agggu cgga      a
--------------c   c  u    uua     c          a     -    ggaagu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 79568500-79568609 [-]
sense
ENSMMUT00000015461 ; TRPM3-203; intron 3
ENSMMUT00000008610 ; TRPM3-201; intron 4
ENSMMUT00000046044 ; TRPM3-202; intron 4
ENSMMUT00000008611 ; TRPM3-204; intron 5
ENSMMUT00000008617 ; TRPM3-205; intron 5
ENSMMUT00000008615 ; TRPM3-207; intron 6
ENSMMUT00000008613 ; TRPM3-206; intron 7
Database links

Mature sequence mml-miR-204-5p

Accession MIMAT0006235
Sequence

33 - 

uucccuuugucauccuaugccu

 - 54

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-204-3p

Accession MIMAT0026843
Sequence

71 - 

ggcugggaaggcaaagggacgu

 - 92

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).