Stem-loop sequence mml-mir-203

Accession MI0007664
Description Macaca mulatta miR-203 stem-loop
Gene family MIPF0000108; mir-203
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-203. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-203 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, such as translational repression and Argonaute-catalyzed messenger RNA cleavage. miR-203 has been identified as a skin-specific microRNA, and it forms an expression gradient that defines the boundary between proliferative epidermal basal progenitors and terminally differentiating suprabasal cells. It has also been found upregulated in psoriasis and differentially expressed in some types of cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g     gg acuc  g         c         u    g    a     - ug 
 ugcug  g    gc cgcuggguc agugguucu aaca uuca caguu c  u
 |||||  |    || ||||||||| ||||||||| |||| |||| ||||| |   
 gcgac  c    cg gcggcccag ucaccagga uugu aagu guuaa g  a
a     ag ggca  g         a         u    a    -     c cg 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 167491760-167491869 [+]
intergenic
Database links

Mature sequence mml-miR-203

Accession MIMAT0006234
Sequence

65 - 

gugaaauguuuaggaccacuag

 - 86

Get sequence
Evidence by similarity; MI0000283
Predicted targets

References

1