Stem-loop sequence mml-mir-200a

AccessionMI0007663 (change log)
DescriptionMacaca mulatta miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

2 open access papers mention mml-mir-200a
(2 sentences)

Stem-loop
   cc   - c   g        -            -----------     a 
5'   ggg c ccu ugagcauc uuaccggacagu           gcugg u
     ||| | ||| |||||||| ||||||||||||           ||||| u
3'   ccc g gga acuuguag aauggucuguca           cgacc u
   ca   a u   a        c            caaucucaguu     c 
Get sequence
Deep sequencing
79738 reads, 444 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 259981-260070 [+]
antisense
ENSMMUT00000019466 ; CPSF3L-204; intron 2
ENSMMUT00000019462 ; CPSF3L-205; intron 2
ENSMMUT00000019463 ; CPSF3L-202; intron 4
ENSMMUT00000047666 ; CPSF3L-201; intron 5
ENSMMUT00000019472 ; CPSF3L-206; intron 5
ENSMMUT00000047665 ; CPSF3L-203; intron 7
Clustered miRNAs
< 10kb from mml-mir-200a
mml-mir-200achr1: 259981-260070 [+]
mml-mir-429chr1: 261052-261134 [+]
Database links

Mature sequence mml-miR-200a-5p

Accession MIMAT0026842
Sequence

16 - 

caucuuaccggacagugcugga

 - 37

Get sequence
Deep sequencing938 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-200a-3p

Accession MIMAT0006233
Sequence

54 - 

uaacacugucugguaacgaugu

 - 75

Get sequence
Deep sequencing78800 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).