Stem-loop sequence mml-mir-199a-2

Accession MI0007662
Description Macaca mulatta miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aac       u        c   u  g ag c 
gcc   ccagugu cagacuac ugu ca g  g u
|||   ||||||| |||||||| ||| || |  |  
cgg   gguuaca gucugaug aca gu c  c c
   auu       c        -   u  g aa u 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 10626280-10626350 [-]
antisense
Database links

Mature sequence mml-miR-199a-5p

Accession MIMAT0006231
Sequence

6 - 

cccaguguucagacuaccuguuc

 - 28

Get sequence
Evidence by similarity; MI0000242
Predicted targets

Mature sequence mml-miR-199a-3p

Accession MIMAT0006232
Sequence

47 - 

acaguagucugcacauugguua

 - 68

Get sequence
Evidence by similarity; MI0000242
Predicted targets

References

1