Stem-loop sequence mml-mir-199a-2

AccessionMI0007662 (change log)
DescriptionMacaca mulatta miR-199a-2 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention mml-mir-199a-2
(2 sentences)

Stem-loop
      aac       u        c   u  g ag c 
5' gcc   ccagugu cagacuac ugu ca g  g u
   |||   ||||||| |||||||| ||| || |  |  
3' cgg   gguuaca gucugaug aca gu c  c c
      auu       c        -   u  g aa u 
Get sequence
Deep sequencing
193655 reads, 1.43e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 10858564-10858634 [-]
antisense
ENSMMUT00000010224 ; C19orf52-201; intron 2
ENSMMUT00000016867 ; SMARCA4-201; intron 25
ENSMMUT00000016868 ; SMARCA4-202; intron 25
Database links

Mature sequence mml-miR-199a-5p

Accession MIMAT0006231
Sequence

6 - 

cccaguguucagacuaccuguuc

 - 28

Get sequence
Deep sequencing15027 reads, 9 experiments
Evidence by similarity; MI0000242
Database links
Predicted targets

Mature sequence mml-miR-199a-3p

Accession MIMAT0006232
Sequence

47 - 

acaguagucugcacauugguua

 - 68

Get sequence
Deep sequencing178627 reads, 9 experiments
Evidence by similarity; MI0000242
Database links
Predicted targets

References

1