Stem-loop sequence mml-mir-197

AccessionMI0007661
DescriptionMacaca mulatta miR-197 stem-loop
Gene family MIPF0000123; mir-197
Stem-loop
        c    a       ca    ga   -   a 
ggcugugc gggu gagaggg  gugg  ggu aag g
|||||||| |||| |||||||  ||||  ||| |||  
ccgguacg ccca cucuucc  cacu  cca uuc c
        a    c       ac    uc   c   u 
Get sequence
Deep sequencing
8956 reads, 154 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 113360995-113361069 [+]
intergenic
Database links

Mature sequence mml-miR-197-5p

Accession MIMAT0026841
Sequence

9 - 

cggguagagagggcagugggag

 - 30

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-197-3p

Accession MIMAT0006230
Sequence

48 - 

uucaccaccuucuccacccagc

 - 69

Get sequence
Deep sequencing28 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).