Stem-loop sequence mml-mir-196b

AccessionMI0007660 (change log)
DescriptionMacaca mulatta miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

2 open access papers mention mml-mir-196b
(2 sentences)

Stem-loop
   acugguc     uuu       u  c           ucca 
5'        gguga   agguagu uc uguuguuggga    c
          |||||   ||||||| || |||||||||||     
3'        uuacu   uccguca ag acgacagcucu    c
   ------a     ---       c  c           cuuu 
Get sequence
Deep sequencing
148309 reads, 900 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 81000144-81000218 [+]
intergenic
Database links

Mature sequence mml-miR-196b-5p

Accession MIMAT0006229
Sequence

15 - 

uagguaguuuccuguuguuggg

 - 36

Get sequence
Deep sequencing148304 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-196b-3p

Accession MIMAT0026840
Sequence

51 - 

cgacagcacgacacugccuuca

 - 72

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).