Stem-loop sequence mml-mir-196a-2

AccessionMI0007659 (change log)
DescriptionMacaca mulatta miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Literature search

1 open access papers mention mml-mir-196a-2
(1 sentences)

Stem-loop
   -ug    - -uc       --c                  a          a ug   
5'    cucg c   agcugau   uguggcuuagguaguuuc uguuguuggg u  ag 
      |||| |   |||||||   |||||||||||||||||| |||||||||| |  | u
3'    gagc g   uuggcug   acauugaguccgucaaag acaacggcuc a  uu 
   cgg    u cuu       acu                  a          a gu   
Get sequence
Deep sequencing
159654 reads, 900 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 52660840-52660949 [+]
intergenic
Database links

Mature sequence mml-miR-196a-5p

Accession MIMAT0002519
Previous IDsmml-miR-196
Sequence

25 - 

uagguaguuucauguuguugg

 - 45

Get sequence
Deep sequencing315992 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-196a-3p

Accession MIMAT0026839
Sequence

63 - 

ggcaacaagaaacugccugag

 - 83

Get sequence
Deep sequencing1035 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).