Stem-loop sequence mml-mir-195

AccessionMI0007658 (change log)
DescriptionMacaca mulatta miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention mml-mir-195
(1 sentences)

Stem-loop
   a   u     g  cu          -a          --cag g 
5'  gcu cccug cu  agcagcacag  aauauuggca     g a
    ||| ||||| ||  ||||||||||  ||||||||||     |  
3'  ugg gggac ga  ucgucguguc  uuauaaccgu     c a
   g   u     g  cc          gg          cugaa g 
Get sequence
Deep sequencing
46014 reads, 211 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 6978210-6978296 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-195
mml-mir-497chr16: 6978507-6978618 [-]
mml-mir-195chr16: 6978210-6978296 [-]
Database links

Mature sequence mml-miR-195-5p

Accession MIMAT0006228
Sequence

15 - 

uagcagcacagaaauauuggc

 - 35

Get sequence
Deep sequencing45399 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-195-3p

Accession MIMAT0026838
Sequence

53 - 

ccaauauuggcugugcugcucca

 - 75

Get sequence
Deep sequencing604 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).