Stem-loop sequence mml-mir-194-2

Accession MI0007657
Description Macaca mulatta miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
   -u     c      cu         a      g     -gu u 
5'   ggcuc cgcccc  guaacagca cuccau uggaa   g c
     ||||| ||||||  ||||||||| |||||| |||||   |  
3'   ccggg gcgggg  uauugucgu ggggug accuu   c c
   gg     a      uc         c      -     agu a
Get sequence
Deep sequencing
92238 reads, 1.85e+03 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr14: 9809323-9809407 [+]
sense
ENSMMUT00000031796 ; NRXN2-202; intron 15
ENSMMUT00000031794 ; NRXN2-201; intron 17
Clustered miRNAs
< 10kb from mml-mir-194-2
mml-mir-194-2 chr14: 9809323-9809407 [+]
mml-mir-192 chr14: 9809516-9809625 [+]
Database links

Mature sequence mml-miR-194-5p

Accession MIMAT0002727
Sequence

15 -  

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing 629 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-194-3p

Accession MIMAT0026837
Sequence

52 -  

caguggggcugcuguuaucug

 - 72

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18186931 "Identification of novel homologous microRNA genes in the rhesus macaque genome" Yue J, Sheng Y, Orwig KE BMC Genomics. 9:8(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).