![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-194-2 |
||||||
Accession | MI0007657 (change log) | |||||
Description | Macaca mulatta miR-194-2 stem-loop | |||||
Gene family | MIPF0000055; mir-194 | |||||
Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin. |
|||||
Stem-loop |
-u c cu a g -gu u 5' ggcuc cgcccc guaacagca cuccau uggaa g c ||||| |||||| ||||||||| |||||| ||||| | 3' ccggg gcgggg uauugucgu ggggug accuu c c gg a uc c - agu a |
|||||
Confidence |
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mml-miR-194-5p |
|
Accession | MIMAT0002727 |
Sequence |
15 - uguaacagcaacuccaugugga - 36 |
Evidence | experimental; Illumina [2] |
Database links |
|
Predicted targets |
|
Mature sequence mml-miR-194-3p |
|
Accession | MIMAT0026837 |
Sequence |
52 - caguggggcugcuguuaucug - 72 |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|