Stem-loop sequence mml-mir-194-2

Accession MI0007657
Description Macaca mulatta miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-u     c      cu         a      g     -gu u 
  ggcuc cgcccc  guaacagca cuccau uggaa   g c
  ||||| ||||||  ||||||||| |||||| |||||   |  
  ccggg gcgggg  uauugucgu ggggug accuu   c c
gg     a      uc         c      -     agu a 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
14: 9556181-9556265 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-194-2
mml-mir-194-2 14: 9556181-9556265 [+]
mml-mir-192 14: 9556374-9556483 [+]
Database links

Mature sequence mml-miR-194

Accession MIMAT0002727
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Evidence by similarity; MI0000488
Predicted targets

References

1