Stem-loop sequence mml-mir-194-2

AccessionMI0007657 (change log)
DescriptionMacaca mulatta miR-194-2 stem-loop
Gene family MIPF0000055; mir-194
Literature search

1 open access papers mention mml-mir-194-2
(1 sentences)

Stem-loop
   -u     c      cu         a      g     -gu u 
5'   ggcuc cgcccc  guaacagca cuccau uggaa   g c
     ||||| ||||||  ||||||||| |||||| |||||   |  
3'   ccggg gcgggg  uauugucgu ggggug accuu   c c
   gg     a      uc         c      -     agu a 
Get sequence
Deep sequencing
102757 reads, 611 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 9567012-9567096 [+]
sense
ENSMMUT00000031796 ; NRXN2-202; intron 15
ENSMMUT00000031794 ; NRXN2-201; intron 17
Clustered miRNAs
< 10kb from mml-mir-194-2
mml-mir-194-2chr14: 9567012-9567096 [+]
mml-mir-192chr14: 9567205-9567314 [+]
Database links

Mature sequence mml-miR-194-5p

Accession MIMAT0002727
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing202750 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-194-3p

Accession MIMAT0026837
Sequence

52 - 

caguggggcugcuguuaucug

 - 72

Get sequence
Deep sequencing1283 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).