miRNA Entry for MI0007657

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

mir-194 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-194
Identifiers
Symbol	mir-194
Rfam	RF00257
miRBase	MI0000488
miRBase family	MIPF0000055
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733)^[1] and in human (MI0000488, MI0000732).^[2] mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

References

^ Lagos-Quintana, M; Rauhut R; Meyer J; Borkhardt A; Tuschl T (2003). "New microRNAs from mouse and human". RNA 9 (2): 175–179. doi:10.1261/rna.2146903. PMC 1370382. PMID 12554859.
^ Michael, MZ; O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ (2003). "Reduced accumulation of specific microRNAs in colorectal neoplasia". Mol Cancer Res 1 (12): 882–891. PMID 14573789. Cite uses deprecated parameters (help)

External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence mml-miR-194-5p
Accession	MIMAT0002727
Sequence	15 - uguaacagcaacuccaugugga - 36 Get sequence
Deep sequencing	629 reads, 7 experiments
Evidence	experimental; Illumina [2]
Predicted targets	TARGETSCAN-VERT:mml-miR-194

Mature sequence mml-miR-194-3p
Accession	MIMAT0026837
Sequence	52 - caguggggcugcuguuaucug - 72 Get sequence
Deep sequencing	2 reads, 2 experiments
Evidence	experimental; Illumina [2]

References
1	PMID:18186931 "Identification of novel homologous microRNA genes in the rhesus macaque genome" Yue J, Sheng Y, Orwig KE BMC Genomics. 9:8(2008).
2	PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).

miRBase

Stem-loop sequence mml-mir-194-2

References

External links

Mature sequence mml-miR-194-5p

Mature sequence mml-miR-194-3p

References