Stem-loop sequence mml-mir-193b

Accession MI0007656
Description Macaca mulatta miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
      gu       u    gu         g  a  ag uua 
5' gug  cucagaa cggg  uuugagggc ag ug  u   u
   |||  ||||||| ||||  ||||||||| || ||  |   g
3' uac  ggguuuu gccc  aaacucccg uc ac  a   u
      ug       c    ug         g  a  cu uuu 
Get sequence
Deep sequencing
2612 reads, 72.6 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr20: 14459743-14459825 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-193b
mml-mir-193b chr20: 14459743-14459825 [+]
mml-mir-365-1 chr20: 14465097-14465183 [+]
Database links

Mature sequence mml-miR-193b-5p

Accession MIMAT0026836
Sequence

14 - 

cgggguuuugagggcgagauga

 - 35

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-193b-3p

Accession MIMAT0006227
Sequence

51 - 

aacuggcccucaaagucccgcu

 - 72

Get sequence
Deep sequencing 4 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).