|
miRBase |
|
Stem-loop sequence mml-mir-193b |
||||||
| Accession | MI0007656 | |||||
| Description | Macaca mulatta miR-193b stem-loop | |||||
| Gene family | MIPF0000082; mir-193 | |||||
| Stem-loop |
gu u gu g a ag uua gug cucagaa cggg uuugagggc ag ug u u ||| ||||||| |||| ||||||||| || || | g uac ggguuuu gccc aaacucccg uc ac a u ug c ug g a cu uuu |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence mml-miR-193b |
|
| Accession | MIMAT0006227 |
| Sequence |
51 - aacuggcccucaaagucccgcu - 72 |
| Evidence | by similarity; MI0003137 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|