Stem-loop sequence mml-mir-193b

Accession MI0007656
Description Macaca mulatta miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   gu       u    gu         g  a  ag uua 
gug  cucagaa cggg  uuugagggc ag ug  u   u
|||  ||||||| ||||  ||||||||| || ||  |   g
uac  ggguuuu gccc  aaacucccg uc ac  a   u
   ug       c    ug         g  a  cu uuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
20: 14416035-14416117 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-193b
mml-mir-193b 20: 14416035-14416117 [+]
mml-mir-365-1 20: 14421395-14421481 [+]
Database links

Mature sequence mml-miR-193b-5p

Accession MIMAT0026836
Sequence

14 - 

cgggguuuugagggcgagauga

 - 35

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-193b-3p

Accession MIMAT0006227
Sequence

51 - 

aacuggcccucaaagucccgcu

 - 72

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).