Stem-loop sequence mml-mir-193a

Accession MI0007655
Description Macaca mulatta miR-193a stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   ggau   a             u     cg   g  a   gggu 
5'     ggg gcugagggcuggg cuuug  ggc ag uga    g
       ||| ||||||||||||| |||||  ||| || |||     
3'     ccc cggcuccugaccc gaaac  ccg uc acu    u
   ---g   c             u     au   g  a   aggc 
Get sequence
Deep sequencing
423 reads, 15.1 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr16: 27490391-27490475 [+]
sense
ENSMMUT00000042013 ; RHOT1-202; intron 1
ENSMMUT00000042012 ; RHOT1-201; intron 1
ENSMMUT00000024751 ; RHOT1-203; intron 1
ENSMMUT00000042011 ; RHOT1-204; intron 1
ENSMMUT00000042010 ; RHOT1-205; intron 1
Database links

Mature sequence mml-miR-193a-5p

Accession MIMAT0006225
Sequence

18 - 

ugggucuuugcgggcgagauga

 - 39

Get sequence
Evidence by similarity; MI0000487
Predicted targets

Mature sequence mml-miR-193a-3p

Accession MIMAT0006226
Sequence

52 - 

aacuggccuacaaagucccagu

 - 73

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence by similarity; MI0000487
Predicted targets

References

1