Stem-loop sequence mml-mir-193a

Accession MI0007655
Description Macaca mulatta miR-193a stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
ggau   a             u     cg   g  a   gggu 
    ggg gcugagggcuggg cuuug  ggc ag uga    g
    ||| ||||||||||||| |||||  ||| || |||     
    ccc cggcuccugaccc gaaac  ccg uc acu    u
---g   c             u     au   g  a   aggc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 26739889-26739973 [+]
intergenic
Database links

Mature sequence mml-miR-193a-5p

Accession MIMAT0006225
Sequence

18 - 

ugggucuuugcgggcgagauga

 - 39

Get sequence
Evidence by similarity; MI0000487
Predicted targets

Mature sequence mml-miR-193a-3p

Accession MIMAT0006226
Sequence

52 - 

aacuggccuacaaagucccagu

 - 73

Get sequence
Evidence by similarity; MI0000487
Predicted targets

References

1