Stem-loop sequence mml-mir-192

AccessionMI0007654 (change log)
DescriptionMacaca mulatta miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

1 open access papers mention mml-mir-192
(1 sentences)

Stem-loop
       a -acc   u  --   g g  c         -     a       ugcucuc 
5' gcug g    gag gc  aca g cu ugaccuaug aauug cagccag       g
   |||| |    ||| ||  ||| | || ||||||||| ||||| |||||||        
3' cgac c    cuc cg  ugu u ga acuggauac uuaac gucgguc       u
       - guaa   -  cu   a g  c         c     c       uccccuc 
Get sequence
Deep sequencing
1476170 reads, 9.56e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 9567205-9567314 [+]
sense
ENSMMUT00000031796 ; NRXN2-202; intron 15
ENSMMUT00000031794 ; NRXN2-201; intron 17
Clustered miRNAs
< 10kb from mml-mir-192
mml-mir-194-2chr14: 9567012-9567096 [+]
mml-mir-192chr14: 9567205-9567314 [+]
Database links

Mature sequence mml-miR-192-5p

Accession MIMAT0006224
Sequence

24 - 

cugaccuaugaauugacagcc

 - 44

Get sequence
Deep sequencing1475965 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-192-3p

Accession MIMAT0026835
Sequence

68 - 

ugccaauuccauaggucacag

 - 88

Get sequence
Deep sequencing198 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).