Stem-loop sequence mml-mir-192

Accession MI0007654
Description Macaca mulatta miR-192 stem-loop
Gene family MIPF0000063; mir-192
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    a -acc   u  --   g g  c         -     a       ugcucuc 
gcug g    gag gc  aca g cu ugaccuaug aauug cagccag       g
|||| |    ||| ||  ||| | || ||||||||| ||||| |||||||        
cgac c    cuc cg  ugu u ga acuggauac uuaac gucgguc       u
    - guaa   -  cu   a g  c         c     c       uccccuc 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
14: 9556374-9556483 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-192
mml-mir-194-2 14: 9556181-9556265 [+]
mml-mir-192 14: 9556374-9556483 [+]
Database links

Mature sequence mml-miR-192

Accession MIMAT0006224
Sequence

24 - 

cugaccuaugaauugacagcc

 - 44

Get sequence
Evidence by similarity; MI0000234
Predicted targets

References

1