Stem-loop sequence mml-mir-191

Accession MI0007653
Description Macaca mulatta miR-191 stem-loop
Gene family MIPF0000194; mir-191
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-191. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-191 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-191 has been found to be dysregulated in a large number of different types of human tumour, including those of colorectal, breast and prostate cancers. Despite these cancer links, target genes of the mature miRNA have not been characterised, and it is not known which factors lead to its dysregulation in certain tumour cells. The expression profile of miR-191 could be implemented in prognosis of acute myeloid leukaemia, with higher than average levels of miR-191 suggesting a lower survival probability.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   u   c      ca         c  aa       uu  -  c 
 ggc gga agcggg  acggaaucc aa  gcagcug  gu cu c
 ||| ||| ||||||  ||||||||| ||  |||||||  || ||  
 ccg ccu ucgucc  ugcuuuagg uu  cgucgac  ua ga a
u   u   c      cc         -  cg       cu  c  g 
Get sequence
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 87437240-87437331 [+]
sense
Clustered miRNAs
< 10kb from mml-mir-191
mml-mir-191 2: 87437240-87437331 [+]
mml-mir-425 2: 87437713-87437799 [+]
Database links

Mature sequence mml-miR-191

Accession MIMAT0006223
Sequence

16 - 

caacggaaucccaaaagcagcug

 - 38

Get sequence
Evidence by similarity; MI0000465
Predicted targets

References

1