Stem-loop sequence mml-mir-191

AccessionMI0007653 (change log)
DescriptionMacaca mulatta miR-191 stem-loop
Gene family MIPF0000194; mir-191
Literature search

2 open access papers mention mml-mir-191
(3 sentences)

Stem-loop
   c   u   c      ca         c  aa       uu  -  c 
5'  ggc gga agcggg  acggaaucc aa  gcagcug  gu cu c
    ||| ||| ||||||  ||||||||| ||  |||||||  || ||  
3'  ccg ccu ucgucc  ugcuuuagg uu  cgucgac  ua ga a
   u   u   c      cc         -  cg       cu  c  g 
Get sequence
Deep sequencing
288111 reads, 2.56e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 93358708-93358799 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-191
mml-mir-191chr2: 93358708-93358799 [+]
mml-mir-425chr2: 93359182-93359268 [+]
Database links

Mature sequence mml-miR-191-5p

Accession MIMAT0006223
Sequence

16 - 

caacggaaucccaaaagcagcug

 - 38

Get sequence
Deep sequencing287412 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-191-3p

Accession MIMAT0026834
Sequence

58 - 

gcugcgcuuggauuucgucccc

 - 79

Get sequence
Deep sequencing699 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).