Stem-loop sequence mml-mir-190b

Accession MI0007652
Description Macaca mulatta miR-190b stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
-u   u     -u               g     -   aa 
  gcu cugug  gauauguuugauauu gguug uuu  u
  ||| |||||  ||||||||||||||| ||||| |||   
  cga gacau  uuauacaaacuguaa ucaac aag  u
gu   c     uc               a     c   ga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 132712583-132712661 [-]
intergenic
Database links

Mature sequence mml-miR-190b

Accession MIMAT0006222
Sequence

11 - 

ugauauguuugauauuggguu

 - 31

Get sequence
Evidence by similarity; MI0005545
Predicted targets

References

1