Stem-loop sequence mml-mir-190b

Accession MI0007652
Description Macaca mulatta miR-190b stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   -u   u     -u               g     -   aa 
5'   gcu cugug  gauauguuugauauu gguug uuu  u
     ||| |||||  ||||||||||||||| ||||| |||   
3'   cga gacau  uuauacaaacuguaa ucaac aag  u
   gu   c     uc               a     c   ga 
Get sequence
Deep sequencing
694 reads, 123 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 133198496-133198574 [-]
intergenic
Database links

Mature sequence mml-miR-190b

Accession MIMAT0006222
Sequence

11 - 

ugauauguuugauauuggguu

 - 31

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence by similarity; MI0005545
Predicted targets

References

1