|
miRBase |
|
Stem-loop sequence mml-mir-190b |
|||||
| Accession | MI0007652 | ||||
| Description | Macaca mulatta miR-190b stem-loop | ||||
| Gene family | MIPF0000076; mir-190 | ||||
| Stem-loop |
-u u -u g - aa gcu cugug gauauguuugauauu gguug uuu u ||| ||||| ||||||||||||||| ||||| ||| cga gacau uuauacaaacuguaa ucaac aag u gu c uc a c ga |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-190b |
|
| Accession | MIMAT0006222 |
| Sequence |
11 - ugauauguuugauauuggguu - 31 |
| Evidence | by similarity; MI0005545 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|