Stem-loop sequence mml-mir-187

DescriptionMacaca mulatta miR-187 stem-loop
Gene family MIPF0000078; mir-187
   ggucaggcucacuaugacacagugugaga    g    a           - -c   ug ug 
5'                              ccuc ggcu caacacaggac c  ggg  c  c
                                |||| |||| ||||||||||| |  |||  |   
3'                              ggag ccga guuguguucug g  ccc  g  u
   ---------------acgccuggacgcag    g    c           u cu   ca uc 
Get sequence
Deep sequencing
1265 reads, 16.4 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr18: 29819491-29819599 [-]
ENSMMUT00000048223 ; KIAA1328-201; intron 4
ENSMMUT00000009599 ; KIAA1328-202; intron 5
Database links

Mature sequence mml-miR-187-5p

Accession MIMAT0026833

35 - 


 - 55

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-187-3p

Accession MIMAT0006221

71 - 


 - 92

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).