Stem-loop sequence mml-mir-187

Accession MI0007651
Description Macaca mulatta miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
ggucaggcucacuaugacacagugugaga    g    a           - -c   ug ug 
                             ccuc ggcu caacacaggac c  ggg  c  c
                             |||| |||| ||||||||||| |  |||  |   
                             ggag ccga guuguguucug g  ccc  g  u
---------------acgccuggacgcag    g    c           u cu   ca uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
18: 28861007-28861115 [-]
intergenic
Database links

Mature sequence mml-miR-187-5p

Accession MIMAT0026833
Sequence

35 - 

ggcuacaacacaggacccggg

 - 55

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-187-3p

Accession MIMAT0006221
Sequence

71 - 

ucgugucuuguguugcagccgg

 - 92

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).