|
miRBase |
|
Stem-loop sequence mml-mir-186 |
|||||
| Accession | MI0007650 | ||||
| Description | Macaca mulatta miR-186 stem-loop | ||||
| Gene family | MIPF0000109; mir-186 | ||||
| Stem-loop |
u u ag u u ucuggu gcuug aacuuuccaa aauuc ccuuu gggcuu u ||||| |||||||||| ||||| ||||| |||||| cgagu uugaaggguu uuaag ggaaa cccgaa u u - cu u - uuuuau |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-186 |
|
| Accession | MIMAT0006220 |
| Sequence |
15 - caaagaauucuccuuuugggcu - 36 |
| Evidence | by similarity; MI0000483 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|