Stem-loop sequence mml-mir-186

Accession MI0007650
Description Macaca mulatta miR-186 stem-loop
Gene family MIPF0000109; mir-186
Stem-loop
u     u          ag     u     u      ucuggu 
 gcuug aacuuuccaa  aauuc ccuuu gggcuu      u
 ||||| ||||||||||  ||||| ||||| ||||||       
 cgagu uugaaggguu  uuaag ggaaa cccgaa      u
u     -          cu     u     -      uuuuau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 73831020-73831105 [-]
sense
ENSMMUT00000024335 ; MMU.13063-201; intron 8
ENSMMUT00000024337 ; MMU.13063-202; intron 8
Database links

Mature sequence mml-miR-186-5p

Accession MIMAT0006220
Sequence

15 - 

caaagaauucuccuuuugggcu

 - 36

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-186-3p

Accession MIMAT0026832
Sequence

55 - 

cccaaaggugaauuucuuggg

 - 75

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).