Stem-loop sequence mml-mir-186

AccessionMI0007650 (change log)
DescriptionMacaca mulatta miR-186 stem-loop
Gene family MIPF0000109; mir-186
Literature search

1 open access papers mention mml-mir-186
(1 sentences)

Stem-loop
   u     u          ag     u     u      ucuggu 
5'  gcuug aacuuuccaa  aauuc ccuuu gggcuu      u
    ||||| ||||||||||  ||||| ||||| ||||||       
3'  cgagu uugaaggguu  uuaag ggaaa cccgaa      u
   u     -          cu     u     -      uuuuau 
Get sequence
Deep sequencing
160996 reads, 867 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 70944320-70944405 [-]
sense
ENSMMUT00000024341 ; NEGR1-201; intron 4
Database links

Mature sequence mml-miR-186-5p

Accession MIMAT0006220
Sequence

15 - 

caaagaauucuccuuuugggcu

 - 36

Get sequence
Deep sequencing160788 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-186-3p

Accession MIMAT0026832
Sequence

55 - 

cccaaaggugaauuucuuggg

 - 75

Get sequence
Deep sequencing208 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).