Stem-loop sequence mml-mir-185

Accession MI0007649
Description Macaca mulatta miR-185 stem-loop
Gene family MIPF0000202; mir-185
Stem-loop
a   c c       ug   a     g          u  uc 
 ggg g gagggau  gag gaaag caguuccuga gg  c
 ||| | |||||||  ||| ||||| |||||||||| ||   
 ccc c cuuccug  cuc cuuuc gucggggacu cc  c
a   u c       gu   -     g          -  uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 64097640-64097721 [+]
intergenic
Database links

Mature sequence mml-miR-185-5p

Accession MIMAT0006219
Sequence

15 - 

uggagagaaaggcaguuccuga

 - 36

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-185-3p

Accession MIMAT0026831
Sequence

50 - 

aggggcuggcuuuccucuggu

 - 70

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).