Stem-loop sequence mml-mir-184

AccessionMI0007648 (change log)
DescriptionMacaca mulatta miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention mml-mir-184
(14 sentences)

Stem-loop
           g c         c      a c     -     g 
5' ucagucac u cccuuauca uuuucc g ccagc uuuau a
   |||||||| | ||||||||| |||||| | ||||| |||||  
3' aguuagug a gggaauagu aagagg c gguug gaaug c
           g u         c      - a     u     u 
Get sequence
Deep sequencing
5291 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 56747751-56747834 [+]
intergenic
Database links

Mature sequence mml-miR-184

Accession MIMAT0006218
Sequence

53 - 

uggacggagaacugauaagggu

 - 74

Get sequence
Deep sequencing5289 reads, 9 experiments
Evidence by similarity; MI0000481
Predicted targets

References

1