Stem-loop sequence mml-mir-181b-2

AccessionMI0007646 (change log)
DescriptionMacaca mulatta miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention mml-mir-181b-2
(7 sentences)

Stem-loop
   cuga   -     cucaa         cu           u  gu 
5'     ugg cugca     cauucauug  gucgguggguu ga  c
       ||| |||||     |||||||||  ||||||||||| ||  u
3'     acc ggcgu     guaaguagc  uagucacucaa cu  g
   acaa   a     caaac         --           -  aa 
Get sequence
Deep sequencing
598452 reads, 2.87e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 14341488-14341576 [-]
sense
ENSMMUT00000022186 ; AUH-201; intron 3
ENSMMUT00000045783 ; AUH-202; intron 3
Clustered miRNAs
< 10kb from mml-mir-181b-2
mml-mir-181a-2chr15: 14342713-14342822 [-]
mml-mir-181b-2chr15: 14341488-14341576 [-]
Database links

Mature sequence mml-miR-181b-5p

Accession MIMAT0002623
Sequence

16 - 

aacauucauugcugucgguggguu

 - 39

Get sequence
Deep sequencing1195673 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-181b-2-3p

Accession MIMAT0031042
Sequence

57 - 

acugaucgaugaaugcaaa

 - 75

Get sequence
Deep sequencing305 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).